Review



addgene plasmi  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Addgene inc addgene plasmi
    Addgene Plasmi, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plvx+ires+puro+vector/pLVX-EF1alpha-SARS-CoV-2-orf3a-2xStrep-IRES-Puro+(Plasmid+%23141383)/pmc12754350-31-15-15
    Average 93 stars, based on 10 article reviews
    addgene plasmi - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Programming tumor evolution with selection gene drives to proactively combat drug resistance.
    Article Snippet: Most targeted anticancer therapies fail due to drug resistance evolution.. Here we show that tumor evolution can be reproducibly redirected to engineer therapeutic opportunity, regardless of the exact ensemble of pre-existing genetic heterogeneity.. We develop a selection gene drive system that is stably introduced into cancer cells and is composed of two genes, or switches, that couple an inducible fitness advantage with a shared fitness cost.

    Article Title: Programmed evolution: Using asexual gene drives to sculpt tumor populations and combat genetic diversity
    Article Snippet: .. 677 678 Construct generation 679 680 PCR-based cloning was used to insert genes of interest (including EGFR L858R, cytosine 681 deaminase, and CD19) into the pLVX-IRES-Puro vector (Addgene). .. Switch 1 constructs were 682 similarly generated by cloning target kinase domains into the pLVX-Hom-Mem1 vector (Takara).

    Article Title: Melanocortin 1 receptor mediates melanin production by interacting with the BBSome in primary cilia.
    Article Snippet: .. Mammalian expression plasmids for MC1R-3×Flag, MC1R-mEmerald, and BBS2-HA were generated by insertion of the cDNAs into the pLVX-IRES puro vector (Addgene), and their mutants were generated by PCR and site-directed mutagenesis. .. BBS2 siRNAs (#1: 50- CUCGGUCAGAACUUUCUGUUA-30; #2: 50-CGGGAUGCAAUUCGAAGCAAU-30; #3: 50- CCUUGGUGAGUUGUACAAAUU-30) were synthesized by RiboBio (Guangzhou, China). shRNAs for BBS2 or Sox9 were cloned into the pLKO.1 vector (Addgene).

    Article Title: Melanocortin 1 receptor mediates melanin production by interacting with the BBSome in primary cilia
    Article Snippet: .. Mammalian expression plasmids for MC1R-3×Flag, MC1R-mEmerald, and BBS2-HA were generated by insertion of the cDNAs into the pLVX-IRES puro vector (Addgene), and their mutants were generated by PCR and site-directed mutagenesis. .. BBS2 siRNAs (#1: 5′- CUCGGUCAGAACUUUCUGUUA-3′ ; #2: 5′-CGGGAUGCAAUUCGAAGCAAU-3′ ; #3: 5′-CCUUGGUGAGUUGUACAAAUU-3′ ) were synthesized by RiboBio (Guangzhou, China). shRNAs for BBS2 or Sox9 were cloned into the pLKO.1 vector (Addgene).

    Cloning:

    Article Title: Programming tumor evolution with selection gene drives to proactively combat drug resistance.
    Article Snippet: Most targeted anticancer therapies fail due to drug resistance evolution.. Here we show that tumor evolution can be reproducibly redirected to engineer therapeutic opportunity, regardless of the exact ensemble of pre-existing genetic heterogeneity.. We develop a selection gene drive system that is stably introduced into cancer cells and is composed of two genes, or switches, that couple an inducible fitness advantage with a shared fitness cost.

    Article Title: Programmed evolution: Using asexual gene drives to sculpt tumor populations and combat genetic diversity
    Article Snippet: .. 677 678 Construct generation 679 680 PCR-based cloning was used to insert genes of interest (including EGFR L858R, cytosine 681 deaminase, and CD19) into the pLVX-IRES-Puro vector (Addgene). .. Switch 1 constructs were 682 similarly generated by cloning target kinase domains into the pLVX-Hom-Mem1 vector (Takara).

    Plasmid Preparation:

    Article Title: Programming tumor evolution with selection gene drives to proactively combat drug resistance.
    Article Snippet: Most targeted anticancer therapies fail due to drug resistance evolution.. Here we show that tumor evolution can be reproducibly redirected to engineer therapeutic opportunity, regardless of the exact ensemble of pre-existing genetic heterogeneity.. We develop a selection gene drive system that is stably introduced into cancer cells and is composed of two genes, or switches, that couple an inducible fitness advantage with a shared fitness cost.

    Article Title: Programmed evolution: Using asexual gene drives to sculpt tumor populations and combat genetic diversity
    Article Snippet: .. 677 678 Construct generation 679 680 PCR-based cloning was used to insert genes of interest (including EGFR L858R, cytosine 681 deaminase, and CD19) into the pLVX-IRES-Puro vector (Addgene). .. Switch 1 constructs were 682 similarly generated by cloning target kinase domains into the pLVX-Hom-Mem1 vector (Takara).

    Article Title: Melanocortin 1 receptor mediates melanin production by interacting with the BBSome in primary cilia.
    Article Snippet: .. Mammalian expression plasmids for MC1R-3×Flag, MC1R-mEmerald, and BBS2-HA were generated by insertion of the cDNAs into the pLVX-IRES puro vector (Addgene), and their mutants were generated by PCR and site-directed mutagenesis. .. BBS2 siRNAs (#1: 50- CUCGGUCAGAACUUUCUGUUA-30; #2: 50-CGGGAUGCAAUUCGAAGCAAU-30; #3: 50- CCUUGGUGAGUUGUACAAAUU-30) were synthesized by RiboBio (Guangzhou, China). shRNAs for BBS2 or Sox9 were cloned into the pLKO.1 vector (Addgene).

    Article Title: UBE2J1 is the E2 ubiquitin-conjugating enzyme regulating androgen receptor degradation and antiandrogen resistance
    Article Snippet: .. All sequences were cloned into pLenti-CMV-P2A-blast vector (Addgene, 17486), or pLVX-IRES-PURO vector (Addgene, 107435). ..

    Article Title: Melanocortin 1 receptor mediates melanin production by interacting with the BBSome in primary cilia
    Article Snippet: .. Mammalian expression plasmids for MC1R-3×Flag, MC1R-mEmerald, and BBS2-HA were generated by insertion of the cDNAs into the pLVX-IRES puro vector (Addgene), and their mutants were generated by PCR and site-directed mutagenesis. .. BBS2 siRNAs (#1: 5′- CUCGGUCAGAACUUUCUGUUA-3′ ; #2: 5′-CGGGAUGCAAUUCGAAGCAAU-3′ ; #3: 5′-CCUUGGUGAGUUGUACAAAUU-3′ ) were synthesized by RiboBio (Guangzhou, China). shRNAs for BBS2 or Sox9 were cloned into the pLKO.1 vector (Addgene).

    Article Title: UBE2J1 is the E2 ubiquitin-conjugating enzyme regulating androgen receptor degradation and antiandrogen resistance.
    Article Snippet: .. All sequences were cloned into pLenti-CMV-P2A-blast vector (Addgene, 17486), or pLVX-IRES-PURO vector (Addgene, 107435). ..

    Article Title: USP11 deubiquitinates E-cadherin and maintains luminal fate of mammary cells to suppress breast cancer
    Article Snippet: The Flag, Flag tagged USP11, and Flag tagged USP11-C318A ectopic expression vectors were constructed in lentivirus vector pLVX-IRES-Puro (Addgene) as pLVX-IRES-Flag, pLVX-IRES-Flag-USP11, and pLVX-IRES-Flag-USP11-C318A, respectively. .. The pLKO.1-puro or pLVX-IRES-Puro vector was used as a backbone plasmid and was co-transfected with packaging plasmid - psPAX2 (Addgene) and envelope plasmid - pMD2.G (Addgene), in a ratio of 9:6:3, into HEK293T cells to package lentivirus. ..

    Construct:

    Article Title: Programmed evolution: Using asexual gene drives to sculpt tumor populations and combat genetic diversity
    Article Snippet: .. 677 678 Construct generation 679 680 PCR-based cloning was used to insert genes of interest (including EGFR L858R, cytosine 681 deaminase, and CD19) into the pLVX-IRES-Puro vector (Addgene). .. Switch 1 constructs were 682 similarly generated by cloning target kinase domains into the pLVX-Hom-Mem1 vector (Takara).

    Clone Assay:

    Article Title: The FBXW7-binding sites on FAM83D are potential targets for cancer therapy
    Article Snippet: The plasmid psPAX2 and pM’2.G (GeneChem Co., Shanghai, China) were used for lentiviral packaging. .. Human FAM83D cDNA was cloned into the pLVX-IRES-Puro vector (Addgene, MA, USA) and the specific shRNAs targeting FAM83D were cloned into the pLKO.1-TRC vector (GenePharma, Shanghai, China) (shRNA1: CCTGACTTTGTCACCTTTGTT and shRNA2: GATCTGAAAGTTCATCCTGAA, designated shFAM83D-1 and shFAM83D-2). ..

    Article Title: UBE2J1 is the E2 ubiquitin-conjugating enzyme regulating androgen receptor degradation and antiandrogen resistance
    Article Snippet: .. All sequences were cloned into pLenti-CMV-P2A-blast vector (Addgene, 17486), or pLVX-IRES-PURO vector (Addgene, 107435). ..

    Article Title: UBE2J1 is the E2 ubiquitin-conjugating enzyme regulating androgen receptor degradation and antiandrogen resistance.
    Article Snippet: .. All sequences were cloned into pLenti-CMV-P2A-blast vector (Addgene, 17486), or pLVX-IRES-PURO vector (Addgene, 107435). ..

    Expressing:

    Article Title: Melanocortin 1 receptor mediates melanin production by interacting with the BBSome in primary cilia.
    Article Snippet: .. Mammalian expression plasmids for MC1R-3×Flag, MC1R-mEmerald, and BBS2-HA were generated by insertion of the cDNAs into the pLVX-IRES puro vector (Addgene), and their mutants were generated by PCR and site-directed mutagenesis. .. BBS2 siRNAs (#1: 50- CUCGGUCAGAACUUUCUGUUA-30; #2: 50-CGGGAUGCAAUUCGAAGCAAU-30; #3: 50- CCUUGGUGAGUUGUACAAAUU-30) were synthesized by RiboBio (Guangzhou, China). shRNAs for BBS2 or Sox9 were cloned into the pLKO.1 vector (Addgene).

    Article Title: Melanocortin 1 receptor mediates melanin production by interacting with the BBSome in primary cilia
    Article Snippet: .. Mammalian expression plasmids for MC1R-3×Flag, MC1R-mEmerald, and BBS2-HA were generated by insertion of the cDNAs into the pLVX-IRES puro vector (Addgene), and their mutants were generated by PCR and site-directed mutagenesis. .. BBS2 siRNAs (#1: 5′- CUCGGUCAGAACUUUCUGUUA-3′ ; #2: 5′-CGGGAUGCAAUUCGAAGCAAU-3′ ; #3: 5′-CCUUGGUGAGUUGUACAAAUU-3′ ) were synthesized by RiboBio (Guangzhou, China). shRNAs for BBS2 or Sox9 were cloned into the pLKO.1 vector (Addgene).

    Generated:

    Article Title: Melanocortin 1 receptor mediates melanin production by interacting with the BBSome in primary cilia.
    Article Snippet: .. Mammalian expression plasmids for MC1R-3×Flag, MC1R-mEmerald, and BBS2-HA were generated by insertion of the cDNAs into the pLVX-IRES puro vector (Addgene), and their mutants were generated by PCR and site-directed mutagenesis. .. BBS2 siRNAs (#1: 50- CUCGGUCAGAACUUUCUGUUA-30; #2: 50-CGGGAUGCAAUUCGAAGCAAU-30; #3: 50- CCUUGGUGAGUUGUACAAAUU-30) were synthesized by RiboBio (Guangzhou, China). shRNAs for BBS2 or Sox9 were cloned into the pLKO.1 vector (Addgene).

    Article Title: Melanocortin 1 receptor mediates melanin production by interacting with the BBSome in primary cilia
    Article Snippet: .. Mammalian expression plasmids for MC1R-3×Flag, MC1R-mEmerald, and BBS2-HA were generated by insertion of the cDNAs into the pLVX-IRES puro vector (Addgene), and their mutants were generated by PCR and site-directed mutagenesis. .. BBS2 siRNAs (#1: 5′- CUCGGUCAGAACUUUCUGUUA-3′ ; #2: 5′-CGGGAUGCAAUUCGAAGCAAU-3′ ; #3: 5′-CCUUGGUGAGUUGUACAAAUU-3′ ) were synthesized by RiboBio (Guangzhou, China). shRNAs for BBS2 or Sox9 were cloned into the pLKO.1 vector (Addgene).

    Mutagenesis:

    Article Title: Melanocortin 1 receptor mediates melanin production by interacting with the BBSome in primary cilia.
    Article Snippet: .. Mammalian expression plasmids for MC1R-3×Flag, MC1R-mEmerald, and BBS2-HA were generated by insertion of the cDNAs into the pLVX-IRES puro vector (Addgene), and their mutants were generated by PCR and site-directed mutagenesis. .. BBS2 siRNAs (#1: 50- CUCGGUCAGAACUUUCUGUUA-30; #2: 50-CGGGAUGCAAUUCGAAGCAAU-30; #3: 50- CCUUGGUGAGUUGUACAAAUU-30) were synthesized by RiboBio (Guangzhou, China). shRNAs for BBS2 or Sox9 were cloned into the pLKO.1 vector (Addgene).

    Article Title: Melanocortin 1 receptor mediates melanin production by interacting with the BBSome in primary cilia
    Article Snippet: .. Mammalian expression plasmids for MC1R-3×Flag, MC1R-mEmerald, and BBS2-HA were generated by insertion of the cDNAs into the pLVX-IRES puro vector (Addgene), and their mutants were generated by PCR and site-directed mutagenesis. .. BBS2 siRNAs (#1: 5′- CUCGGUCAGAACUUUCUGUUA-3′ ; #2: 5′-CGGGAUGCAAUUCGAAGCAAU-3′ ; #3: 5′-CCUUGGUGAGUUGUACAAAUU-3′ ) were synthesized by RiboBio (Guangzhou, China). shRNAs for BBS2 or Sox9 were cloned into the pLKO.1 vector (Addgene).



    Similar Products

    96
    TaKaRa lentiviral vector plvx ires puro
    Lentiviral Vector Plvx Ires Puro, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plvx+ires+puro+vector/Puromycin/pmc12872855-173-10-13
    Average 96 stars, based on 1 article reviews
    lentiviral vector plvx ires puro - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    TaKaRa plvx puro
    Plvx Puro, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plvx+ires+puro+vector/pLVX-EF1alpha-IRES-mCherry+Vector/us12551547-314-14-15
    Average 96 stars, based on 1 article reviews
    plvx puro - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    TaKaRa plvx ires puro vector
    Plvx Ires Puro Vector, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plvx+ires+puro+vector/Puromycin/us12516123-153-33-35
    Average 96 stars, based on 1 article reviews
    plvx ires puro vector - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    TaKaRa lentivirus vector plvx ires puro
    Lentivirus Vector Plvx Ires Puro, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plvx+ires+puro+vector/Puromycin/pmc12827466-280-11-14
    Average 96 stars, based on 1 article reviews
    lentivirus vector plvx ires puro - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    TaKaRa plvx ef1α ires puro lentiviral vector
    Plvx Ef1α Ires Puro Lentiviral Vector, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plvx+ires+puro+vector/Puromycin/pm41286199-327-23-26
    Average 96 stars, based on 1 article reviews
    plvx ef1α ires puro lentiviral vector - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    93
    Addgene inc addgene plasmi
    Addgene Plasmi, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plvx+ires+puro+vector/pLVX-EF1alpha-SARS-CoV-2-orf3a-2xStrep-IRES-Puro+(Plasmid+%23141383)/pmc12754350-31-15-15
    Average 93 stars, based on 1 article reviews
    addgene plasmi - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    96
    TaKaRa plvx ef1alpha ires puro vector
    Plvx Ef1alpha Ires Puro Vector, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plvx+ires+puro+vector/pLVX-EF1alpha-IRES-mCherry+Vector/bio_rxiv__2025__09__29__679146-281-17-19
    Average 96 stars, based on 1 article reviews
    plvx ef1alpha ires puro vector - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    TaKaRa expression vector plvx ef1a ires puro
    Expression Vector Plvx Ef1a Ires Puro, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plvx+ires+puro+vector/Puromycin/10__1186_slash_s43042___025___00786___5-101-23-27
    Average 96 stars, based on 1 article reviews
    expression vector plvx ef1a ires puro - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    TaKaRa plvx ires puro lentiviral vector
    Plvx Ires Puro Lentiviral Vector, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plvx+ires+puro+vector/Puromycin/pmc12426703-47-15-18
    Average 96 stars, based on 1 article reviews
    plvx ires puro lentiviral vector - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    Image Search Results